IGF1 (NM_001111285) Human 3' UTR Clone

CAT#: SC201276

3`UTR clone of insulin-like growth factor 1 (somatomedin C) (IGF1) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: IGF1
• Synonyms: IGF; IGF-I; IGFI; MGF
• ACCN: NM_001111285
• Insert Size: 152 bp
• Sequence Data:
  Insert Sequence

  >SC201276 3'UTR clone of NM_001111285
  The sequence shown below is from the reference sequence of NM_001111285. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGCTGAATGCAGAGGCAAAAAAGGAAAATGAAGGACAGGAGGATTAAACAGACAGAGGCAAGGATGATGA
  GAGAGGAGCAGACAGCAAGAATGAAAAGCAGAAAATACAATAGAGGAAATGAAGAAAAGTAGGCCTGCTG
  GAGCTAGATGAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001111285.1
• Summary: 'The protein encoded by this gene is similar to insulin in function and structure and is a member of a family of proteins involved in mediating growth and development. The encoded protein is processed from a precursor, bound by a specific receptor, and secreted. Defects in this gene are a cause of insulin-like growth factor I deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]'
• Locus ID: 3479