acyl CoA Thioesterase 2 (ACOT2) (NM_006821) Human 3' UTR Clone

CAT#: SC201282

3`UTR clone of acyl-CoA thioesterase 2 (ACOT2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ACOT2
• Synonyms: CTE-IA; CTE1A; MTE1; PTE2; PTE2A; ZAP128
• ACCN: NM_006821
• Insert Size: 160
• Sequence Data:
  Insert Sequence

  >SC201282 3'UTR clone of NM_006821
  The sequence shown below is from the reference sequence of NM_006821. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGACAATCCCATCAAAAGTGTAAATTTTATTTGATCATGTGGCCTCTCTGTTGCTAATCTCTCCTGGAAA
  CATCTGCCACATTTAGTGTGTGTATGTGTATTCATTCTTTTGTTTTTAATAACTAAAGTTTTTTCCCCTC
  ATTATTAAAATGAATTTACC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006821.4
• Summary: This gene encodes a member of the acyl-CoA thioesterase protein family, and is one of four acyl-CoA hydrolase genes located in a cluster on chromosome 14. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
• Locus ID: 10965