UCKL1 (NM_017859) Human 3' UTR Clone

CAT#: SC201299

3`UTR clone of uridine-cytidine kinase 1-like 1 (UCKL1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UCKL1
• Synonyms: UCK1L; URKL1
• ACCN: NM_017859
• Insert Size: 155
• Sequence Data:
  Insert Sequence

  >SC201299 3'UTR clone of NM_017859
  The sequence shown below is from the reference sequence of NM_017859. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGATGGCAGTGACGAGGAGGAAGTGGCCTACACGGGTTAGCTGCCCAGTGAGCCATCCCGTCCCCACCAC
  CCTCCTCCTGCCTCCTGACCCAGGACTGCTGAATACAAAGATGTTAATTTTTAAAATGTTACTAGTATAA
  TTTATTCTATGCATT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_017859.2
• Summary: The protein encoded by this gene is a uridine kinase. Uridine kinases catalyze the phosphorylation of uridine to uridine monophosphate. This protein has been shown to bind to Epstein-Barr nuclear antigen 3 as well as natural killer lytic-associated molecule. Ubiquitination of this protein is enhanced by the presence of natural killer lytic-associated molecule. In addition, protein levels decrease in the presence of natural killer lytic-associated molecule, suggesting that association with natural killer lytic-associated molecule results in ubiquitination and subsequent degradation of this protein. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
• Locus ID: 54963