Ubiquitin (UBB) (NM_018955) Human 3' UTR Clone

CAT#: SC201303

3`UTR clone of ubiquitin B (UBB) for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol UBB
Synonyms HEL-S-50
ACCN NM_018955
Insert Size 160 bp
Sequence Data
>SC201303 3'UTR clone of NM_018955
The sequence shown below is from the reference sequence of NM_018955. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGAGTCGACCCTGCACCTGGTCCTGCGCCTGAGGGGTGGCTGTTAATTCTTCAGTCATGGCATTCGCAGT
GCCCAGTGATGGCATTACTCTGCACTATAGCCATTTGCCCCAACTTAAGTTTAGAAATTACAAGTTTCAG
TAATAGCTGAACCTGTTCAA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_018955.2
Summary 'This gene encodes ubiquitin, one of the most conserved proteins known. Ubiquitin has a major role in targeting cellular proteins for degradation by the 26S proteosome. It is also involved in the maintenance of chromatin structure, the regulation of gene expression, and the stress response. Ubiquitin is synthesized as a precursor protein consisting of either polyubiquitin chains or a single ubiquitin moiety fused to an unrelated protein. This gene consists of three direct repeats of the ubiquitin coding sequence with no spacer sequence. Consequently, the protein is expressed as a polyubiquitin precursor with a final amino acid after the last repeat. An aberrant form of this protein has been detected in patients with Alzheimer's disease and Down syndrome. Pseudogenes of this gene are located on chromosomes 1, 2, 13, and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]'
Locus ID 7314

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.