COX17 (NM_005694) Human 3' UTR Clone

CAT#: SC201323

3`UTR clone of COX17 cytochrome c oxidase assembly homolog (S. cerevisiae) (COX17) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: COX17
• Synonyms: MGC104397; MGC117386
• ACCN: NM_005694
• Insert Size: 170
• Sequence Data:
  Insert Sequence

  >SC201323 3'UTR clone of NM_005694
  The sequence shown below is from the reference sequence of NM_005694. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGGAATGCATGAGAGCCCTAGGATTTAAAATATGAAATGGTGGTCTGCTGTGTGAATAAATAATTCCT
  GAAGAATGAAGAAGATTAATTTTGGGAGTTCTTTGACGAACTTTGATATGTGGAAAAAGTATTTATAATT
  TATTGTAAGAAGAAAGTAAAATATTACTAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005694.1
• Summary: Cytochrome c oxidase (COX), the terminal component of the mitochondrial respiratory chain, catalyzes the electron transfer from reduced cytochrome c to oxygen. This component is a heteromeric complex consisting of 3 catalytic subunits encoded by mitochondrial genes and multiple structural subunits encoded by nuclear genes. The mitochondrially-encoded subunits function in electron transfer, and the nuclear-encoded subunits may function in the regulation and assembly of the complex. This nuclear gene encodes a protein which is not a structural subunit, but may be involved in the recruitment of copper to mitochondria for incorporation into the COX apoenzyme. This protein shares 92% amino acid sequence identity with mouse and rat Cox17 proteins. This gene is no longer considered to be a candidate gene for COX deficiency. A pseudogene COX17P has been found on chromosome 13. [provided by RefSeq, Jul 2008]
• Locus ID: 10063