Apc4 (ANAPC4) (NM_013367) Human 3' UTR Clone

CAT#: SC201328

3`UTR clone of anaphase promoting complex subunit 4 (ANAPC4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ANAPC4
• Synonyms: APC4
• ACCN: NM_013367
• Insert Size: 112
• Sequence Data:
  Insert Sequence

  >SC201328 3'UTR clone of NM_013367
  The sequence shown below is from the reference sequence of NM_013367. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACTTGACCCTGAGCTAGACTCCTAATCTAGCTTGCCATTATTGTGTGTGTAATTATGGCCAAAAGGACAT
  AGGAGATGGACTAAGATGTCTTGGACCACCTTTGTGTAACAA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_013367.2
• Summary: A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
• Locus ID: 29945