ERAB (HSD17B10) (NM_004493) Human 3' UTR Clone

CAT#: SC201339

3`UTR clone of hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "HSD17B10"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol HSD17B10
Synonyms 17b-HSD10; ABAD; CAMR; DUPXp11.22; ERAB; HADH2; HCD2; HSD10MD; MHBD; MRPP2; MRX17; MRX31; MRXS10; SCHAD; SDR5C1
ACCN NM_004493
Insert Size 146 bp
Sequence Data
>SC201339 3'UTR clone of NM_004493
The sequence shown below is from the reference sequence of NM_004493. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GCCATTCGTATGCAGCCTTGAAGGGAGAAGGCAGAGAAAACACACGCTCCTCTGCCCTTCCTTTCCCTGG
GGTACTACTCTCCAGCTTGGGAGGAAGCCCAGTAGCCATTTTGTAACTGCCTACCAGTCGCCCTCTGTGC
CTAATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_004493.2
Summary 'This gene encodes 3-hydroxyacyl-CoA dehydrogenase type II, a member of the short-chain dehydrogenase/reductase superfamily. The gene product is a mitochondrial protein that catalyzes the oxidation of a wide variety of fatty acids and steroids, and is a subunit of mitochondrial ribonuclease P, which is involved in tRNA maturation. The protein has been implicated in the development of Alzheimer disease, and mutations in the gene are the cause of 17beta-hydroxysteroid dehydrogenase type 10 (HSD10) deficiency. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Aug 2014]'
Locus ID 3028

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.