ERAB (HSD17B10) (NM_001037811) Human 3' UTR Clone

CAT#: SC201342

3`UTR clone of hydroxysteroid (17-beta) dehydrogenase 10 (HSD17B10) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: HSD17B10
• Synonyms: 17b-HSD10; ABAD; CAMR; DUPXp11.22; ERAB; HADH2; HCD2; HSD10MD; MHBD; MRPP2; MRX17; MRX31; MRXS10; SCHAD; SDR5C1
• ACCN: NM_001037811
• Insert Size: 146 bp
• Sequence Data:
  Insert Sequence

  >SC201342 3'UTR clone of NM_001037811
  The sequence shown below is from the reference sequence of NM_001037811. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCCATTCGTATGCAGCCTTGAAGGGAGAAGGCAGAGAAAACACACGCTCCTCTGCCCTTCCTTTCCCTGG
  GGTACTACTCTCCAGCTTGGGAGGAAGCCCAGTAGCCATTTTGTAACTGCCTACCAGTCGCCCTCTGTGC
  CTAATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001037811.2
• Summary: 'This gene encodes 3-hydroxyacyl-CoA dehydrogenase type II, a member of the short-chain dehydrogenase/reductase superfamily. The gene product is a mitochondrial protein that catalyzes the oxidation of a wide variety of fatty acids and steroids, and is a subunit of mitochondrial ribonuclease P, which is involved in tRNA maturation. The protein has been implicated in the development of Alzheimer disease, and mutations in the gene are the cause of 17beta-hydroxysteroid dehydrogenase type 10 (HSD10) deficiency. Several alternatively spliced transcript variants have been identified, but the full-length nature of only two transcript variants has been determined. [provided by RefSeq, Aug 2014]'
• Locus ID: 3028