ALAS1 (NM_000688) Human 3' UTR Clone

CAT#: SC201356

3`UTR clone of aminolevulinate delta- synthase 1 (ALAS1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ALAS1
• Synonyms: ALAS; ALAS-H; ALAS3; ALASH; MIG4
• ACCN: NM_000688
• Insert Size: 175 bp
• Sequence Data:
  Insert Sequence

  >SC201356 3'UTR clone of NM_000688
  The sequence shown below is from the reference sequence of NM_000688. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCTCAGGCTTGAGCAAGTTGGTATCTGCTCAGGCCTGAGCATGACCTCAATTATTTCACTTAACCCCAGG
  CCATTATCATATCCAGATGGTCTTCAGAGTTGTCTTTATATGTGAATTAAGTTATATTAAATTTTAATCT
  ATAGTAAAAACATAGTCCTGGAAATAAATTCTTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000688.4
• Summary: 'This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]'
• Locus ID: 211