NDUFA1 (NM_004541) Human 3' UTR Clone

CAT#: SC201370

3`UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex1 7.5kDa (NDUFA1) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFA1
• Synonyms: CI-MWFE; MC1DN12; MWFE; ZNF183
• ACCN: NM_004541
• Insert Size: 145 bp
• Sequence Data:
  Insert Sequence

  >SC201370 3'UTR clone of NM_004541
  The sequence shown below is from the reference sequence of NM_004541. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGTTACTATGTGTCAAAGGGTTTGGAGAACATTGATTAAGGAAGCATTTTCCTGATTGATGAAAAAAATA
  ACTCAGTTATGGCCATCTACCCCTGCTAGAAGGTTACAGTGTATTATGTAGCATGCAATGTGTTATGTAG
  TGCTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004541.3
• Summary: 'The human NDUFA1 gene codes for an essential component of complex I of the respiratory chain, which transfers electrons from NADH to ubiquinone. It has been noted that the N-terminal hydrophobic domain has the potential to be folded into an alpha-helix spanning the inner mitochondrial membrane with a C-terminal hydrophilic domain interacting with globular subunits of complex I. The highly conserved two-domain structure suggests that this feature is critical for the protein function and might act as an anchor for the NADH:ubiquinone oxidoreductase complex at the inner mitochondrial membrane. However, the NDUFA1 peptide is one of about 31 components of the "hydrophobic protein" (HP) fraction of complex I which is involved in proton translocation. Thus the NDUFA1 peptide may also participate in that function. [provided by RefSeq, Jul 2008]'
• Locus ID: 4694