NDUFS5 (NM_004552) Human 3' UTR Clone

CAT#: SC201371

3`UTR clone of NADH dehydrogenase (ubiquinone) Fe-S protein 5 15kDa (NADH-coenzyme Q reductase) (NDUFS5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFS5
• Synonyms: CI-15k; CI15K
• ACCN: NM_004552
• Insert Size: 129 bp
• Sequence Data:
  Insert Sequence

  >SC201371 3'UTR clone of NM_004552
  The sequence shown below is from the reference sequence of NM_004552. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCACCACATTGGCAAGGGGGAGCCTCGGCCCTGAACAGAGCAGCTGCTGATGTCTGGAGGCTGATTTT
  CCTGTTCTCTGTTCTCCACTGGAAAGGTTGTTTACGACAAACCTCCTTGTCAAAGTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004552.1
• Summary: 'This gene is a member of the NADH dehydrogenase (ubiquinone) iron-sulfur protein family. The encoded protein is a subunit of the NADH:ubiquinone oxidoreductase (complex I), the first enzyme complex in the electron transport chain located in the inner mitochondrial membrane. Alternative splicing results in multiple transcript variants and pseudogenes have been identified on chromosomes 1, 4 and 17. [provided by RefSeq, May 2010]'
• Locus ID: 4725