NDUFB3 (NM_002491) Human 3' UTR Clone

CAT#: SC201394

3`UTR clone of NADH dehydrogenase (ubiquinone) 1 beta subcomplex3 12kDa (NDUFB3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFB3
• Synonyms: B12; CI-B12; MC1DN25
• ACCN: NM_002491
• Insert Size: 154 bp
• Sequence Data:
  Insert Sequence

  >SC201394 3'UTR clone of NM_002491
  The sequence shown below is from the reference sequence of NM_002491. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TATTACCTGGAGTCCCTGAATAAAGATAAGAAGCATCACTGAAGATAATACCTGGAAGCATCATAGTGGT
  TTCTTAACTCTCCAAAATAAGATTTCTTCTCTGTAGCCTACTTGTCTGGTTTATCCCTTACAGAATATTA
  GTAAGATTTAATCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002491.2
• Summary: 'This gene encodes an accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) which is the first enzyme in the electron transport chain of mitochondria. This protein localizes to the inner membrane of the mitochondrion as a single-pass membrane protein. Mutations in this gene contribute to mitochondrial complex 1 deficiency. Alternative splicing results in multiple transcript variants encoding the same protein. Humans have multiple pseudogenes of this gene. [provided by RefSeq, Mar 2012]'
• Locus ID: 4709