MCM7 (NM_005916) Human 3' UTR Clone

CAT#: SC201424

3`UTR clone of minichromosome maintenance complex component 7 (MCM7) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: MCM7
• Synonyms: CDC47; MCM2; P1.1-MCM3; P1CDC47; P85MCM; PNAS146; PPP1R104
• ACCN: NM_005916
• Insert Size: 174 bp
• Sequence Data:
  Insert Sequence

  >SC201424 3'UTR clone of NM_005916
  The sequence shown below is from the reference sequence of NM_005916. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGTCTGGCAGGTCAATGCTTCCCGGACACGGATCACTTTTGTCTGATTCCAGCCTGCTTGCAACCCTGG
  GGTCCTCTTGTTCCCTGCTGGCCTGCCCCTTGGGAAGGGGCAGTGATGCCTTTGAGGGGAAGGAGGAGCC
  CCTCTTTCTCCCATGCTGCACTTACTCCTTTTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005916.3
• Summary: 'The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are essential for the initiation of eukaryotic genome replication. The hexameric protein complex formed by the MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. The MCM complex consisting of this protein and MCM2, 4 and 6 proteins possesses DNA helicase activity, and may act as a DNA unwinding enzyme. Cyclin D1-dependent kinase, CDK4, is found to associate with this protein, and may regulate the binding of this protein with the tumorsuppressor protein RB1/RB. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]'
• Locus ID: 4176