DNase I (DNASE1) (NM_005223) Human 3' UTR Clone

CAT#: SC201430

3`UTR clone of deoxyribonuclease I (DNASE1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DNASE1
• Synonyms: DNL1; DRNI
• ACCN: NM_005223
• Insert Size: 180 bp
• Sequence Data:
  Insert Sequence

  >SC201430 3'UTR clone of NM_005223
  The sequence shown below is from the reference sequence of NM_005223. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAGCCATCAGTGACCACTATCCAGTGGAGGTGATGCTGAAGTGAGCAGCCCCTCCCCACACCAGTTGAA
  CTGCAGGAAGAGAGGACCCATCCTGCCACAGGACCCAGAAAAAAAGCCCAACACACACTCGGGTTAAGAA
  ATACCTTTAAATTTAGGTAAATAAAGCTCAAGGAGGTGGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005223.3
• Summary: 'This gene encodes a member of the DNase family. This protein is stored in the zymogen granules of the nuclear envelope and functions by cleaving DNA in an endonucleolytic manner. At least six autosomal codominant alleles have been characterized, DNASE1*1 through DNASE1*6, and the sequence of DNASE1*2 represented in this record. Mutations in this gene have been associated with systemic lupus erythematosus (SLE), an autoimmune disease. A recombinant form of this protein is used to treat the one of the symptoms of cystic fibrosis by hydrolyzing the extracellular DNA in sputum and reducing its viscosity. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]'
• Locus ID: 1773