FARS2 (NM_006567) Human 3' UTR Clone

CAT#: SC201458

3`UTR clone of phenylalanyl-tRNA synthetase 2 mitochondrial (FARS2) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: FARS2
• Synonyms: COXPD14; FARS1; HSPC320; mtPheRS; PheRS; SPG77
• ACCN: NM_006567
• Insert Size: 152
• Sequence Data:
  Insert Sequence

  >SC201458 3'UTR clone of NM_006567
  The sequence shown below is from the reference sequence of NM_006567. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTTGGGTGTGGAGGGCAGGTTCTGATGTCACCACTTCACTCAGGCTGCAGCCCTCTTGGGGCTCCAGGA
  TTTGCTGAAAGAGAAAAAGATATGGTTTGTGAACTGGGGCATCAATCATCTTTTGATAAATGGATCAGTT
  TTAGGACTTTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006567.3
• Summary: This gene encodes a protein that transfers phenylalanine to its cognate tRNA. This protein localizes to the mitochondrion and plays a role in mitochondrial protein translation. Mutations in this gene can cause combined oxidative phosphorylation deficiency 14 (Alpers encephalopathy). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
• Locus ID: 10667