EXOSC7 (NM_015004) Human 3' UTR Clone

CAT#: SC201462

3`UTR clone of exosome component 7 (EXOSC7) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EXOSC7
• Synonyms: EAP1; hRrp42p; p8; RRP42; Rrp42p
• ACCN: NM_015004
• Insert Size: 132
• Sequence Data:
  Insert Sequence

  >SC201462 3'UTR clone of NM_015004
  The sequence shown below is from the reference sequence of NM_015004. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GAGACAGAAAGTTGGATTCCTGGGATGATTTGCACATCAACTGCTCAACTGTGGATTGTTTTTTACTTTT
  CCTTTTAAACCGGTTCGTATATATTTTTCTTCGCTGTTACGAATTTACAGCAGCATTTGTAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_015004.3
• Summary: Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes. [UniProtKB/Swiss-Prot Function]
• Locus ID: 23016