THBS4 (NM_003248) Human 3' UTR Clone

CAT#: SC201504

3`UTR clone of thrombospondin 4 (THBS4) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: THBS4
• Synonyms: TSP-4; TSP4
• ACCN: NM_003248
• Insert Size: 165 bp
• Sequence Data:
  Insert Sequence

  >SC201504 3'UTR clone of NM_003248
  The sequence shown below is from the reference sequence of NM_003248. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAAACCCAGAATTTCGACCGCTTCGATAATTAAACCAAGGAAGCAATCTGTAACTGCTTTTCGGAACACT
  AAAACCATATATATTTTAACTTCAATTTTCTTTAGCTTTTACCAACCCAAATATATCAAAACGTTTTATG
  TGAATGTGGCAATAAAGGAGAAGAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003248.4
• Summary: 'The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]'
• Locus ID: 7060