EYA3 (NM_001990) Human 3' UTR Clone

CAT#: SC201534

3`UTR clone of eyes absent homolog 3 (Drosophila) (EYA3) for miRNA target validation

Reconstitution Protocol

USD 560.00

5 Days*

Size
    • 10 ug

Product Images

Other products for "EYA3"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol EYA3
Synonyms DKFZp686C132
ACCN NM_001990
Insert Size 186 bp
Sequence Data
>SC201534 3'UTR clone of NM_001990
The sequence shown below is from the reference sequence of NM_001990. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GTATCCCTTCACCAGGCTTTAGAGCTTGATTTTCTCTAAGAACTGGAATGAGGAGCCTTCCCCTTGAGCT
CCTTTTCACTCCTGAAGGGAGCTGGAGACTGGAACCAACTGAGAACTTTCTCTGTCTGTCTCTCTCTGTG
TCTCTGTCTCTATCTCTCTCTCTTTCTCTCTTTCTCTCTCTCCCTC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001990.2
Summary 'This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may act as a transcriptional activator and have a role during development. It can act as a mediator of chemoresistance and cell survival in Ewing sarcoma cells, where this gene is up-regulated via a micro-RNA that binds to the 3' UTR of the transcript. A similar protein in mice acts as a transcriptional activator. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Sep 2013]'
Locus ID 2140

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.