Chemerin (RARRES2) (NM_002889) Human 3' UTR Clone

CAT#: SC201538

3`UTR clone of retinoic acid receptor responder (tazarotene induced) 2 (RARRES2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RARRES2
• Synonyms: HP10433; TIG2
• ACCN: NM_002889
• Insert Size: 157 bp
• Sequence Data:
  Insert Sequence

  >SC201538 3'UTR clone of NM_002889
  The sequence shown below is from the reference sequence of NM_002889. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGGACAGTTCGCCTTCTCCAAGGCCCTGCCCCGCAGCTAAGCCAGCACTGAGATGCGTGGTGCCTCCAG
  GACCGCTGCGGGTGGTAACCAGTGGAAGACCCCAGCCCCCAGGGAGAGGAACCCGTTCTATCCCCAGCCA
  TGATAATAAAGCTGCTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002889.3
• Summary: 'This gene encodes a secreted chemotactic protein that initiates chemotaxis via the ChemR23 G protein-coupled seven-transmembrane domain ligand. Expression of this gene is upregulated by the synthetic retinoid tazarotene and occurs in a wide variety of tissues. The active protein has several roles, including that as an adipokine and as an antimicrobial protein with activity against bacteria and fungi. [provided by RefSeq, Nov 2014]'
• Locus ID: 5919