Macrophage inflammatory protein 5 (CCL15) (NM_032965) Human 3' UTR Clone

CAT#: SC201547

3`UTR clone of chemokine (C-C motif) ligand 15 (CCL15) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: CCL15
• Synonyms: HCC-2; HMRP-2B; LKN-1; LKN1; MIP-1 delta; MIP-1D; MIP-5; MRP-2B; NCC-3; NCC3; SCYA15; SCYL3; SY15
• ACCN: NM_032965
• Insert Size: 179 bp
• Sequence Data:
  Insert Sequence

  >SC201547 3'UTR clone of NM_032965
  The sequence shown below is from the reference sequence of NM_032965. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CGGGAGTTCAGGATTGCATGAAAAAGCTGAAGCCCTACTCAATATAATAATAAAGAGACAAAAGAGGCCA
  GCCACCCACCTCCAACACCTCCTGTGAGTTTCTTGGTCTGAAATACTTAAAAAATATATATATTGTTGTG
  TCTGGTAATGAAAGTAATGCATCTAATAAAGAGTATTCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_032965.3
• Summary: 'This gene is located in a cluster of similar genes in the same region of chromosome 17. These genes encode CC cytokines, which are secreted proteins characterized by two adjacent cysteines. The product of this gene is chemotactic for T cells and monocytes, and acts through C-C chemokine receptor type 1 (CCR1). The proprotein is further processed into numerous smaller functional peptides. Naturally-occurring readthrough transcripts occur from this gene into the downstream gene, CCL14 (chemokine (C-C motif) ligand 14). [provided by RefSeq, Jan 2013]'
• Locus ID: 6359