AIMP2 (NM_006303) Human 3' UTR Clone

CAT#: SC201563

3`UTR clone of aminoacyl tRNA synthetase complex-interacting multifunctional protein 2 (AIMP2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: AIMP2
• Synonyms: JTV-1; JTV1; P38; PRO0992
• ACCN: NM_006303
• Insert Size: 159
• Sequence Data:
  Insert Sequence

  >SC201563 3'UTR clone of NM_006303
  The sequence shown below is from the reference sequence of NM_006303. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGGCTCCTTTTAACACGGCCCTCAAGCTCCTTAAGTGAATTGCCGTAACTGATTTTAAAGGGTTTAGATT
  TTAAGAATGGTGCTCTTTCATGCCTATTATCAGTAAGGGGACTTGTATTAGAGTCAGAGTCTTTTTATTT
  AGGCCAGTTGTCAAGTGTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006303.3
• Summary: The protein encoded by this gene is part of the aminoacyl-tRNA synthetase complex, which contains nine different aminoacyl-tRNA synthetases and three non-enzymatic factors. The encoded protein is one of the non-enzymatic factors and is required for assembly and stability of the complex. [provided by RefSeq, May 2016]
• Locus ID: 7965