NFkB p100 / p52 (NFKB2) (NM_002502) Human 3' UTR Clone

CAT#: SC201571

3`UTR clone of nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) (NFKB2) transcript variant 2 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NFKB2"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NFKB2
Synonyms CVID10; H2TF1; LYT-10; LYT10; NF-kB2; p49/p100; p52; p100
ACCN NM_002502
Insert Size 144 bp
Sequence Data
>SC201571 3'UTR clone of NM_002502
The sequence shown below is from the reference sequence of NM_002502. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAGCCTCAGGTGCACTGACCTGCTGCCTGCCCCCAGCCCCCTTCCCGGACCCCCTGTACAGCGTCCCCA
CCTATTTCAAATCTTATTTAACACCCCACACCCACCCCTCAGTTGGGACAAATAAAGGATTCTCATGGGA
AGGG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_002502.3
Summary 'This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]'
Locus ID 4791

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.