NFkB p100 / p52 (NFKB2) (NM_001077493) Human 3' UTR Clone

CAT#: SC201572

3`UTR clone of nuclear factor of kappa light polypeptide gene enhancer in B-cells 2 (p49/p100) (NFKB2) transcript variant 3 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NFKB2
• Synonyms: LYT-10; LYT10; p52
• ACCN: NM_001077493
• Insert Size: 144 bp
• Sequence Data:
  Insert Sequence

  >SC201572 3'UTR clone of NM_001077493
  The sequence shown below is from the reference sequence of NM_001077493. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCAGCCTCAGGTGCACTGACCTGCTGCCTGCCCCCAGCCCCCTTCCCGGACCCCCTGTACAGCGTCCCCA
  CCTATTTCAAATCTTATTTAACACCCCACACCCACCCCTCAGTTGGGACAAATAAAGGATTCTCATGGGA
  AGGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_001077493.1
• Summary: 'This gene encodes a subunit of the transcription factor complex nuclear factor-kappa-B (NFkB). The NFkB complex is expressed in numerous cell types and functions as a central activator of genes involved in inflammation and immune function. The protein encoded by this gene can function as both a transcriptional activator or repressor depending on its dimerization partner. The p100 full-length protein is co-translationally processed into a p52 active form. Chromosomal rearrangements and translocations of this locus have been observed in B cell lymphomas, some of which may result in the formation of fusion proteins. There is a pseudogene for this gene on chromosome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]'
• Locus ID: 4791