Ceramide glucosyltransferase (UGCG) (NM_003358) Human 3' UTR Clone

CAT#: SC201609

3`UTR clone of UDP-glucose ceramide glucosyltransferase (UGCG) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: UGCG
• Synonyms: GCS; GLCT1
• ACCN: NM_003358
• Insert Size: 184 bp
• Sequence Data:
  Insert Sequence

  >SC201609 3'UTR clone of NM_003358
  The sequence shown below is from the reference sequence of NM_003358. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTACAGCAGAGGAAATCCTAGATGTATAACTACAGCTTTGTGACTGTATATAAAGGAAAAAAGAGAAGT
  ATTATAAATTATGTTTATATAAATGCTTTTAAAAATCTACCTTCTGTAGTTTTATCACATGTATGTTTTG
  GTATCTGTTCTTTAATTTATTTTTGCATGGCACTTGCATCTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_003358.1
• Summary: 'This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]'
• Locus ID: 7357