TGF beta 1 (TGFB1) (NM_000660) Human 3' UTR Clone

CAT#: SC201611

3`UTR clone of transforming growth factor beta 1 (TGFB1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TGFB1
• Synonyms: CED; DPD1; IBDIMDE; LAP; TGF-beta1; TGFB; TGFbeta
• ACCN: NM_000660
• Insert Size: 181 bp
• Sequence Data:
  Insert Sequence

  >SC201611 3'UTR clone of NM_000660
  The sequence shown below is from the reference sequence of NM_000660. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTGTCCAACATGATCGTGCGCTCCTGCAAGTGCAGCTGAGGTCCCGCCCCGCCCCGCCCCGCCCCGGCAG
  GCCCGGCCCCACCCCGCCCCGCCCCCGCTGCCTTGCCCATGGGGGCTGTATTTAAGGACACCCGTGCCCC
  AAGCCCACCTGGGGCCCCATTAAAGATGGAGAGAGGACTGC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000660.4
• Summary: 'This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGFB family members. This encoded protein regulates cell proliferation, differentiation and growth, and can modulate expression and activation of other growth factors including interferon gamma and tumor necrosis factor alpha. This gene is frequently upregulated in tumor cells, and mutations in this gene result in Camurati-Engelmann disease. [provided by RefSeq, Aug 2016]'
• Locus ID: 7040