SAP155 (SF3B1) (NM_001005526) Human 3' UTR Clone

CAT#: SC201636

3`UTR clone of splicing factor 3b subunit 1 155kDa (SF3B1) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SF3B1
• Synonyms: Hsh155; MDS; PRP10; PRPF10; SAP155; SF3b155
• ACCN: NM_001005526
• Insert Size: 149
• Sequence Data:
  Insert Sequence

  >SC201636 3'UTR clone of NM_001005526
  The sequence shown below is from the reference sequence of NM_001005526. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCGTCTTGATCCTTTTGCAGATGGCTTCTATTCTGCTGCTTGAAGTCAGAACTGCTGATGGAGACAAAGG
  CACGAAAGTGTACGTATTCCGGATTAGCAACCCAGGAACCCATCACTTCTGAAGACTCTAAACTGTGCTG
  TCATTTTGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_001005526.1
• Summary: This gene encodes subunit 1 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. The carboxy-terminal two-thirds of subunit 1 have 22 non-identical, tandem HEAT repeats that form rod-like, helical structures. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
• Locus ID: 23451