U2AF35 (U2AF1) (NM_006758) Human 3' UTR Clone

CAT#: SC201639

3`UTR clone of U2 small nuclear RNA auxiliary factor 1 (U2AF1) transcript variant a for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: U2AF1
• Synonyms: FP793; RN; RNU2AF1; U2AF35; U2AFBP
• ACCN: NM_006758
• Insert Size: 157 bp
• Sequence Data:
  Insert Sequence

  >SC201639 3'UTR clone of NM_006758
  The sequence shown below is from the reference sequence of NM_006758. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GGTCGAGAGATCGTGAAAGATCTGGGCGATTCTGAGCCATGCCATTTTTACCTTATGTCTGCTAGAAAGT
  GTTGTAGTTGATTGACCAAACCAGTTCATAAGGGGAATTTTTTTTAAAAAACAACAAAAAAAAAAACATA
  CAAAGATGGGTTTCTGA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_006758.2
• Summary: 'This gene belongs to the splicing factor SR family of genes. U2 auxiliary factor, comprising a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the small subunit which plays a critical role in both constitutive and enhancer-dependent RNA splicing by directly mediating interactions between the large subunit and proteins bound to the enhancers. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
• Locus ID: 7307