U2AF35 (U2AF1) (NM_001025204) Human 3' UTR Clone

CAT#: SC201641

3`UTR clone of U2 small nuclear RNA auxiliary factor 1 (U2AF1) transcript variant c for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "U2AF1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol U2AF1
Synonyms FP793; RN; RNU2AF1; U2AF35; U2AFBP
ACCN NM_001025204
Insert Size 157 bp
Sequence Data
>SC201641 3'UTR clone of NM_001025204
The sequence shown below is from the reference sequence of NM_001025204. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGTCGAGAGATCGTGAAAGATCTGGGCGATTCTGAGCCATGCCATTTTTACCTTATGTCTGCTAGAAAGT
GTTGTAGTTGATTGACCAAACCAGTTCATAAGGGGAATTTTTTTTAAAAAACAACAAAAAAAAAAACATA
CAAAGATGGGTTTCTGA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_001025204.1
Summary 'This gene belongs to the splicing factor SR family of genes. U2 auxiliary factor, comprising a large and a small subunit, is a non-snRNP protein required for the binding of U2 snRNP to the pre-mRNA branch site. This gene encodes the small subunit which plays a critical role in both constitutive and enhancer-dependent RNA splicing by directly mediating interactions between the large subunit and proteins bound to the enhancers. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]'
Locus ID 7307

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.