DCPS (NM_014026) Human 3' UTR Clone

CAT#: SC201648

3`UTR clone of decapping enzyme scavenger (DCPS) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DCPS
• Synonyms: ARS; DCS1; HINT-5; HINT5; HSL1; HSPC015
• ACCN: NM_014026
• Insert Size: 151
• Sequence Data:
  Insert Sequence

  >SC201648 3'UTR clone of NM_014026
  The sequence shown below is from the reference sequence of NM_014026. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CTCAAGCTCTTGCAGGAGGCTCAGCAAAGCTGAATTAACTCAGGCAGAAGAGCACAGATGTGTGGGATTG
  GGGGAGGAGTGGGGACAAGATTTTTTATCTCCAAGTGAATTTTCTAAAAATGTATTTTATACCGGCTTAT
  TCCTAGTATTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014026.3
• Summary: This gene encodes a member of the histidine triad family of pyrophosphatases that removes short mRNA fragments containing the 5′ mRNA cap structure, which appear in the 3′ → 5′ mRNA decay pathway, following deadenylation and exosome-mediated turnover. This enzyme hydrolyzes the triphosphate linkage of the cap structure (7-methylguanosine nucleoside triphosphate) to yield 7-methylguanosine monophosphate and nucleoside diphosphate. It protects the cell from the potentially toxic accumulation of these short, capped mRNA fragments, and regulates the activity of other cap-binding proteins, which are inhibited by their accumulation. It also acts as a transcript-specific modulator of pre-mRNA splicing and microRNA turnover. [provided by RefSeq, Apr 2017]
• Locus ID: 28960