Exosome Component 9 (EXOSC9) (NM_005033) Human 3' UTR Clone

CAT#: SC201651

3`UTR clone of exosome component 9 (EXOSC9) transcript variant 2 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: EXOSC9
• Synonyms: p5; p6; PCH1D; PM/Scl-75; PMSCL1; RRP45; Rrp45p
• ACCN: NM_005033
• Insert Size: 180 bp
• Sequence Data:
  Insert Sequence

  >SC201651 3'UTR clone of NM_005033
  The sequence shown below is from the reference sequence of NM_005033. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AAGAAGAGAGCTGCCAATTAAAGCTAACAGTTGTATATCTGTATATATAACTATTAAAAGGGATATTTAT
  TCCATTCTGAGAACCCTGGGTATTTTTTATTCACAAATCCATTATAAAATCTAGCAGGATTTTAAAAATA
  GTTTTTTGTTTTTAATGTGCTTTAAAATAATAAACCTTCT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005033.2
• Summary: 'This gene encodes a component of the human exosome, a exoribonuclease complex which processes and degrades RNA in the nucleus and cytoplasm. This component may play a role in mRNA degradation and the polymyositis/scleroderma autoantigen complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]'
• Locus ID: 5393