SAMM50 (NM_015380) Human 3' UTR Clone

CAT#: SC201662

3`UTR clone of sorting and assembly machinery component 50 homolog (S. cerevisiae) (SAMM50) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "SAMM50"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol SAMM50
Synonyms CGI-51; OMP85; SAM50; TOB55; TRG-3; YNL026W
ACCN NM_015380
Insert Size 171
Sequence Data
>SC201662 3'UTR clone of NM_015380
The sequence shown below is from the reference sequence of NM_015380. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

ATGTGATGGCGTCCAGTTTGGAGCTGGGATAAGGTTCCTGTAGCCGACACCCCTACAGGAGAAGCTCTGG
GACTGGGGCAGCAGCAAGGCGCCCATGCCACACACCGTCTCTCGAGGAAACGCGGTTCAGCGATTCTTTG
ACTGCGGACCCTGTGGGAAACCCCGTCAATA

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_015380.4
Summary This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane. [provided by RefSeq, Jun 2011]
Locus ID 25813

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.