PCK2 (NM_004563) Human 3' UTR Clone

CAT#: SC201663

3`UTR clone of phosphoenolpyruvate carboxykinase 2 (mitochondrial) (PCK2) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PCK2
• Synonyms: PEPCK; PEPCK-M; PEPCK2
• ACCN: NM_004563
• Insert Size: 181 bp
• Sequence Data:
  Insert Sequence

  >SC201663 3'UTR clone of NM_004563
  The sequence shown below is from the reference sequence of NM_004563. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TGTTGGCTGAGCTTGAGGCCCTGGAGAGACGTGTGCACAAAATGTGACCTGAGGCCCTAGTCTAGCAAGA
  GGACATAGCACCCTCATCTGGGAATAGGGAAGGCACCTTGCAGAAAATATGAGCAATTTGATATTAACTA
  ACATCTTCAATGTGCCATAGACCTTCCCACAAAGACTGTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_004563.2
• Summary: 'This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]'
• Locus ID: 5106