HE4 (WFDC2) (NM_006103) Human 3' UTR Clone

CAT#: SC201666

3`UTR clone of WAP four-disulfide core domain 2 (WFDC2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: WFDC2
• Synonyms: dJ461P17.6; EDDM4; HE4; WAP5
• ACCN: NM_006103
• Insert Size: 184
• Sequence Data:
  Insert Sequence

  >SC201666 3'UTR clone of NM_006103
  The sequence shown below is from the reference sequence of NM_006103. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AATGGCTGTGGGAAGGTGTCCTGTGTCACTCCCAATTTCTGAGCTCCAGCCACCACCAGGCTGAGCAGTG
  AGGAGAGAAAGTTTCTGCCTGGCCCTGCATCTGGTTCCAGCCCACCTGCCCTCCCCTTTTTCGGGACTCT
  GTATTCCCTCTTGGGCTGACCACAGCTTCTCCCTTTCCCAACCA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006103.3
• Summary: This gene encodes a protein that is a member of the WFDC domain family. The WFDC domain, or WAP Signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor in many family members. This gene is expressed in pulmonary epithelial cells, and was also found to be expressed in some ovarian cancers. The encoded protein is a small secretory protein, which may be involved in sperm maturation. [provided by RefSeq, Jul 2008]
• Locus ID: 10406