ATP5F1E (NM_006886) Human 3' UTR Clone

CAT#: SC201679

3`UTR clone of ATP synthase H+ transporting mitochondrial F1 complex epsilon subunit (ATP5E) nuclear gene encoding mitochondrial protein for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATP5F1E"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol ATP5F1E
Synonyms ATP5E; ATPE; MC5DN3
ACCN NM_006886
Insert Size 213 bp
Sequence Data
>SC201679 3'UTR clone of NM_006886
The sequence shown below is from the reference sequence of NM_006886. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGACTTCTGGCAGCAACGTAAAAATTGTGAAAGTAAAGAAGGAATAATCTACCCTGACTAAAGCTTGAAA
TGCTACATTTCCAAGGTGAAGATGTGTGGGCACATGTTATGGCAGATTGAAAAGGATCTCATTCCATGGG
AAAAAAAAAAATCCTGTCTTGTTCATAAATTGACAATGTCAATAAATTGAAATATGGTTCACTGTTACTC
TTG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_006886.2
Summary 'This gene encodes a subunit of mitochondrial ATP synthase. Mitochondrial ATP synthase catalyzes ATP synthesis, utilizing an electrochemical gradient of protons across the inner membrane during oxidative phosphorylation. ATP synthase is composed of two linked multi-subunit complexes: the soluble catalytic core, F1, and the membrane-spanning component, Fo, comprising the proton channel. The catalytic portion of mitochondrial ATP synthase consists of 5 different subunits (alpha, beta, gamma, delta, and epsilon) assembled with a stoichiometry of 3 alpha, 3 beta, and a single representative of the other 3. The proton channel consists of three main subunits (a, b, c). This gene encodes the epsilon subunit of the catalytic core. Two pseudogenes of this gene are located on chromosomes 4 and 13. Read-through transcripts that include exons from this gene are expressed from the upstream gene SLMO2.[provided by RefSeq, Mar 2011]'
Locus ID 514

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.