SHFM1 (NM_006304) Human 3' UTR Clone

CAT#: SC201694

3`UTR clone of split hand/foot malformation (ectrodactyly) type 1 (SHFM1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SHFM1
• Synonyms: DSS1; ECD; SEM1; SHFD1; Shfdg1; SHSF1
• ACCN: NM_006304
• Insert Size: 180
• Sequence Data:
  Insert Sequence

  >SC201694 3'UTR clone of NM_006304
  The sequence shown below is from the reference sequence of NM_006304. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACGAGCTGAACTAGAGAAACATGGTTATAAGATGGAGACTTCATAGCATCCAGAAGAAGTGTTGAAGTAA
  CCTAAACTTGACCTGCTTAATACATTCTAGGGCAGAGAACCCAGGATGGGACACTAAAAAAATGTGTTTA
  TTTCATTATCTGCTTGGATTTATTTGTGTTTTTGTAACAC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006304.1
• Summary: The product of this gene has been localized within the split hand/split foot malformation locus SHFM1 at chromosome 7. It has been proposed to be a candidate gene for the autosomal dominant form of the heterogeneous limb developmental disorder split hand/split foot malformation type 1. In addition, it has been shown to directly interact with BRCA2. It also may play a role in the completion of the cell cycle. [provided by RefSeq, Jul 2008]
• Locus ID: 7979