ROR1 (NM_005012) Human 3' UTR Clone

CAT#: SC201720

3`UTR clone of receptor tyrosine kinase-like orphan receptor 1 (ROR1) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ROR1
• Synonyms: dJ537F10.1; NTRKR1
• ACCN: NM_005012
• Insert Size: 190 bp
• Sequence Data:
  Insert Sequence

  >SC201720 3'UTR clone of NM_005012
  The sequence shown below is from the reference sequence of NM_005012. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ATGGACACACCGAATCTATGATTTCTGCAGAACTGTAAAATGCACAACTTTTGTAAATGTGGTATACAGG
  ACAAACTAGACGGCCGTAGAAAAGATTTATATTCAAATGTTTTTATTAAAGTAAGGTTCTCATTTAGCAG
  ACATCGCAACAAGTACCTTCTGTGAAGTTTCACTGTGTCTTACCAAGCAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_005012.2
• Summary: 'This gene encodes a receptor tyrosine kinase-like orphan receptor that modulates neurite growth in the central nervous system. The encoded protein is a glycosylated type I membrane protein that belongs to the ROR subfamily of cell surface receptors. It is a pseudokinase that lacks catalytic activity and may interact with the non-canonical Wnt signalling pathway. This gene is highly expressed during early embryonic development but expressed at very low levels in adult tissues. Increased expression of this gene is associated with B-cell chronic lymphocytic leukaemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2012]'
• Locus ID: 4919