DCP1B (NM_152640) Human 3' UTR Clone

CAT#: SC201741

3`UTR clone of DCP1 decapping enzyme homolog B (S. cerevisiae) (DCP1B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: DCP1B
• Synonyms: DCP1
• ACCN: NM_152640
• Insert Size: 173
• Sequence Data:
  Insert Sequence

  >SC201741 3'UTR clone of NM_152640
  The sequence shown below is from the reference sequence of NM_152640. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GCATGACTCAAGCAGCCATGAAAAAGACTATGTGACAGCAAGGCCTTTTAAAACTGATTTTCAAGGTCCT
  TCTAGAACTCCGGCACAAGGTTCTTTCATGTTGAGTGTTGTTTCCTTCAATGTTTCTGCCTTTTTTAAAA
  AAAAAGTATGTGTAATATGAAGTAAAATGTTTC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_152640.3
• Summary: This gene encodes a member of a family of proteins that function in removing the 5' cap from mRNAs, which is a step in regulated mRNA decay. This protein localizes to cytoplasmic foci which are the site of mRNA breakdown and turnover. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
• Locus ID: 196513