GTF2A1 (NM_015859) Human 3' UTR Clone

CAT#: SC201783

3`UTR clone of general transcription factor IIA1 19/37kDa (GTF2A1) transcript variant 1 for miRNA target validation

Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "GTF2A1"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol GTF2A1
Synonyms TF2A1; TFIIA; TFIIA-42; TFIIAL
ACCN NM_015859
Insert Size 184 bp
Sequence Data
>SC201783 3'UTR clone of NM_015859
The sequence shown below is from the reference sequence of NM_015859. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

CCAAAGCCATTGGAGATGCAGAATGGTGAAGAGTTGCTTTTTTTCTTTTATAAATAAAAGAAACTTAAAA
AAAATGTAAAGCGGACAGTTTGAAACTTGGGGCATATGCCAACCAAAACTTCGTTTCTGCATGTCAGAAA
AGTGCAGTAGAAGCAAAGCTACTGGAACAAAGATAGACCTTGAC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.
Reference Data
RefSeq NM_015859.2
Summary 'Accurate transcription initiation on TATA-containing class II genes involves the ordered assembly of RNA polymerase II (POLR2A; MIM 180660) and several general initiation factors (summarized by DeJong and Roeder, 1993 [PubMed 8224848]). One of these factors is TFIIA, which when purified from HeLa extracts consists of 35-, 19-, and 12-kD subunits.[supplied by OMIM, Jul 2010]'
Locus ID 2957

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.