Transcription factor 25 (TCF25) (NM_014972) Human 3' UTR Clone

CAT#: SC201793

3`UTR clone of transcription factor 25 (basic helix-loop-helix) (TCF25) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: TCF25
• Synonyms: FKSG26; hKIAA1049; Hulp1; NULP1; PRO2620
• ACCN: NM_014972
• Insert Size: 161
• Sequence Data:
  Insert Sequence

  >SC201793 3'UTR clone of NM_014972
  The sequence shown below is from the reference sequence of NM_014972. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CACGAGGACGACGCTGAGGGGGAGGGGGAGTGGGACTGAGCGTCCGCAGAGGTGACCGAAAAGCCGTATG
  ATGATGTTCCCGATTTCTCTGTTGGTCGGAGTCGGCCAGTTGCCTGAAGTAGGGAAGCTGAGTGTGTCGC
  TCCCTGGTCCACTGTTTCTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014972.2
• Summary: TCF25 is a member of the basic helix-loop-helix (bHLH) family of transcription factors that are important in embryonic development (Steen and Lindholm, 2008 [PubMed 18068114]). [supplied by OMIM, Sep 2008]
• Locus ID: 22980