ME3 (NM_006680) Human 3' UTR Clone

CAT#: SC201798

3`UTR clone of malic enzyme 3 NADP(+)-dependent mitochondrial (ME3) nuclear gene encoding mitochondrial protein transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ME3
• Synonyms: NADP-ME
• ACCN: NM_006680
• Insert Size: 168
• Sequence Data:
  Insert Sequence

  >SC201798 3'UTR clone of NM_006680
  The sequence shown below is from the reference sequence of NM_006680. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATGAATGTTCAGACGGTCTGAGGCAGTCTCAGAGGCTAGTATGGGGCTAGATGAAGCCCAGAGTAACA
  CCCACAATATAAATGGGTTCCAAAATGGCCCAAGTGAATCCTTGTCGCTGTGTTTTTTCTTTTAAACTTT
  CTGGTGTGAGAGGAGATGCCAAGGCATA
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006680.2
• Summary: Malic enzyme catalyzes the oxidative decarboxylation of malate to pyruvate using either NAD+ or NADP+ as a cofactor. Mammalian tissues contain 3 distinct isoforms of malic enzyme: a cytosolic NADP(+)-dependent isoform, a mitochondrial NADP(+)-dependent isoform, and a mitochondrial NAD(+)-dependent isoform. This gene encodes a mitochondrial NADP(+)-dependent isoform. Multiple alternatively spliced transcript variants have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
• Locus ID: 10873