NDUFA7 (NM_005001) Human 3' UTR Clone

CAT#: SC201808

3`UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex7 14.5kDa (NDUFA7) for miRNA target validation


Reconstitution Protocol

USD 560.00

4 Weeks*

Size
    • 10 ug

Product Images

Other products for "NDUFA7"

Specifications

Product Data
Vector pMirTarget
Species Human
Transfection Reporter RFP
Assay Reporter Luciferase
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Symbol NDUFA7
Synonyms B14.5a; CI-B14.5a
ACCN NM_005001
Insert Size 173
Sequence Data
>SC201808 3'UTR clone of NM_005001
The sequence shown below is from the reference sequence of NM_005001. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GACCAGCCTTACCTGTGACACTGCACCCTCACGGCCACCCGACTACTTTGCCTCCTTGGATTTCCTCCAG
GGAGAATGTGACCTAATTTATGACAAATACGTAGAGCTCAGGTATCACTTCTAGTTTTACTTTAAAAAAT
AAAAAAATAGAGACAGAGTCTCACCATGTTTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_005001.2
Summary This gene encodes a subunit of NADH:ubiquinone oxidoreductase (complex I), which is a multiprotein complex located in the inner mitochondrial membrane. Complex I functions in the transfer of electrons from NADH to the respiratory chain. [provided by RefSeq, Mar 2011]
Locus ID 4701

Documents

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.