NDUFA7 (NM_005001) Human 3' UTR Clone

CAT#: SC201808

3`UTR clone of NADH dehydrogenase (ubiquinone) 1 alpha subcomplex7 14.5kDa (NDUFA7) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: NDUFA7
• Synonyms: B14.5a; CI-B14.5a
• ACCN: NM_005001
• Insert Size: 173
• Sequence Data:
  Insert Sequence

  >SC201808 3'UTR clone of NM_005001
  The sequence shown below is from the reference sequence of NM_005001. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACCAGCCTTACCTGTGACACTGCACCCTCACGGCCACCCGACTACTTTGCCTCCTTGGATTTCCTCCAG
  GGAGAATGTGACCTAATTTATGACAAATACGTAGAGCTCAGGTATCACTTCTAGTTTTACTTTAAAAAAT
  AAAAAAATAGAGACAGAGTCTCACCATGTTTCC
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005001.2
• Summary: This gene encodes a subunit of NADH:ubiquinone oxidoreductase (complex I), which is a multiprotein complex located in the inner mitochondrial membrane. Complex I functions in the transfer of electrons from NADH to the respiratory chain. [provided by RefSeq, Mar 2011]
• Locus ID: 4701