SF3B2 (NM_006842) Human 3' UTR Clone

CAT#: SC201821

3`UTR clone of splicing factor 3b subunit 2 145kDa (SF3B2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: SF3B2
• Synonyms: Cus1; SAP145; SF3b1; SF3B145; SF3b150
• ACCN: NM_006842
• Insert Size: 179
• Sequence Data:
  Insert Sequence

  >SC201821 3'UTR clone of NM_006842
  The sequence shown below is from the reference sequence of NM_006842. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CAGCAAGAAATATAAGGAGTTCAAGTTTTAGGTCCCCTCACACTAGCCCTTTTTTTGGCCCTACGTCTGG
  ATGCCTGGGCTTCACACAAGAACCACCTCTCCCGCAGTTCCCAAGGACTTGTCATTTCATGTTCTTATTT
  TAGACCTGTTTTGTAAATAAAGCTGTTTCCCAAGGAAAG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_006842.2
• Summary: This gene encodes subunit 2 of the splicing factor 3b protein complex. Splicing factor 3b, together with splicing factor 3a and a 12S RNA unit, forms the U2 small nuclear ribonucleoproteins complex (U2 snRNP). The splicing factor 3b/3a complex binds pre-mRNA upstream of the intron's branch site in a sequence-independent manner and may anchor the U2 snRNP to the pre-mRNA. Splicing factor 3b is also a component of the minor U12-type spliceosome. Subunit 2 associates with pre-mRNA upstream of the branch site at the anchoring site. Subunit 2 also interacts directly with subunit 4 of the splicing factor 3b complex. Subunit 2 is a highly hydrophilic protein with a proline-rich N-terminus and a glutamate-rich stretch in the C-terminus. [provided by RefSeq, Jul 2008]
• Locus ID: 10992