Pepsin (PGA5) (NM_014224) Human 3' UTR Clone

CAT#: SC201841

3`UTR clone of pepsinogen 5 group I (pepsinogen A) (PGA5) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: PGA5
• Synonyms: Pg5
• ACCN: NM_014224
• Insert Size: 215 bp
• Sequence Data:
  Insert Sequence

  >SC201841 3'UTR clone of NM_014224
  The sequence shown below is from the reference sequence of NM_014224. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  ACAGGGCAAACAACCAGGTCGGCCTGGCCCCTGTGGCTTAAGCCTAAGTCTCTTCAGCCACCTCCCAGGA
  AGATCTGGCCTCCGTCCTATGCCCACTTTAGATGTATCTAATTCTCCTGACTGTTCTTCCCAGGGGAGTG
  TGAAGGTCTTGGCCCTGTTCCCTGTCCTACCAATAACGTAGAATAAAAACATAACCCACTGAAACAGGTT
  TTGTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_014224.2
• Summary: 'This gene encodes a protein precursor of the digestive enzyme pepsin, a member of the peptidase A1 family of endopeptidases. The encoded precursor is secreted by gastric chief cells and undergoes autocatalytic cleavage in acidic conditions to form the active enzyme, which functions in the digestion of dietary proteins. This gene is found in a cluster of related genes on chromosome 11, each of which encodes one of multiple pepsinogens. Pepsinogen levels in serum may serve as a biomarker for atrophic gastritis and gastric cancer. [provided by RefSeq, Jul 2015]'
• Locus ID: 5222