ROC1 (RBX1) (NM_014248) Human 3' UTR Clone

CAT#: SC201843

3`UTR clone of ring-box 1 (RBX1) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: RBX1
• Synonyms: BA554C12.1; RNF75; ROC1
• ACCN: NM_014248
• Insert Size: 220
• Sequence Data:
  Insert Sequence

  >SC201843 3'UTR clone of NM_014248
  The sequence shown below is from the reference sequence of NM_014248. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GTCCATTGGACAACAGAGAGTGGGAATTCCAAAAGTATGGGCACTAGGAAAAGACTTCTTCCATCAAGCT
  TAATTGTTTTGTTATTCATTTAATGACTTTCCCTGCTGTTACCTAATTACAAATTGGATGGAACTGTGTT
  TTTTTCTGCTTTGTTTTTTCAGTTTGCTGTTTCTGTAGCCATATTGTATTCTGTGTCAAATAAAGTCCAG
  TTGGATTCTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_014248.2
• Summary: This locus encodes a RING finger-like domain-containing protein. The encoded protein interacts with cullin proteins and likely plays a role in ubiquitination processes necessary for cell cycle progression. This protein may also affect protein turnover. Related pseudogenes exist on chromosomes 2 and 5. [provided by RefSeq, Sep 2010]
• Locus ID: 9978