Galectin 3 (LGALS3) (NM_002306) Human 3' UTR Clone

CAT#: SC201846

3`UTR clone of lectin galactoside-binding soluble 3 (LGALS3) transcript variant 1 for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: LGALS3
• Synonyms: CBP35; GAL3; GALBP; GALIG; L31; LGALS2; MAC2
• ACCN: NM_002306
• Insert Size: 192 bp
• Sequence Data:
  Insert Sequence

  >SC201846 3'UTR clone of NM_002306
  The sequence shown below is from the reference sequence of NM_002306. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GACATAGACCTCACCAGTGCTTCATATACCATGATATAATCTGAAAGGGGCAGATTAAAAAAAAAAAAAG
  AATCTAAACCTTACATGTGTAAAGGTTTCATGTTCACTGTGAGTGAAAATTTTTACATTCATCAATATCC
  CTCTTGTAAGTCATCTACTTAATAAATATTACAGTGAATTACCTGTCTCAAT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_002306.3
• Summary: 'This gene encodes a member of the galectin family of carbohydrate binding proteins. Members of this protein family have an affinity for beta-galactosides. The encoded protein is characterized by an N-terminal proline-rich tandem repeat domain and a single C-terminal carbohydrate recognition domain. This protein can self-associate through the N-terminal domain allowing it to bind to multivalent saccharide ligands. This protein localizes to the extracellular matrix, the cytoplasm and the nucleus. This protein plays a role in numerous cellular functions including apoptosis, innate immunity, cell adhesion and T-cell regulation. The protein exhibits antimicrobial activity against bacteria and fungi. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Oct 2014]'
• Locus ID: 3958