OXCT2 (NM_022120) Human 3' UTR Clone

CAT#: SC201859

3`UTR clone of 3-oxoacid CoA transferase 2 (OXCT2) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: OXCT2
• Synonyms: FKSG25; SCOTT
• ACCN: NM_022120
• Insert Size: 178
• Sequence Data:
  Insert Sequence

  >SC201859 3'UTR clone of NM_022120
  The sequence shown below is from the reference sequence of NM_022120. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCATGCAGCAGGTGGCACCCTGACGGGACCTGGATCTGGGCGGGGTGGTGCGCTCCTCAGGGCGGGTGCC
  ACCGGGTTCCCCAGGGGAATACATGTCCCCAGCTCTGGGAGGGGTTTGCTACTGGCCTCCTACTTTCCTC
  CCTAGGTGGACAGTGCTCCTCTAGAGAGCTGCGACTTT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_022120.1
• Summary: The protein encoded by this gene catalyzes the transfer of a CoA group from succinate to acetoacetate and is an important enzyme in ketone body catabolism. The encoded protein localizes to the mitochondrion. This gene is intronless, and a pseudogene of this gene is located elsewhere on chromosome 1. [provided by RefSeq, Aug 2016]
• Locus ID: 64064