BLM (NM_000057) Human 3' UTR Clone

CAT#: SC201861

3`UTR clone of Bloom syndrome RecQ helicase-like (BLM) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: BLM
• Synonyms: BS; MGRISCE1; RECQ2; RECQL2; RECQL3
• ACCN: NM_000057
• Insert Size: 181 bp
• Sequence Data:
  Insert Sequence

  >SC201861 3'UTR clone of NM_000057
  The sequence shown below is from the reference sequence of NM_000057. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  AGACCGTTTCTTAAGCCTTCATATGCATTCTCATAACAACCGAATCTCAATGTACATAGACCCTCTTTCT
  TGTTTGTCAGCATCTGACCATCTGTGACTATAAAGCTGTTATTCTTGTTATACCATTTGAAGTTTTTACT
  CGTCTCTATTAATATTTAAATAAATGCTGGGGGGTGATAGT
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000057.2
• Summary: 'The Bloom syndrome is an autosomal recessive disorder characterized by growth deficiency, microcephaly and immunodeficiency among others. It is caused by homozygous or compound heterozygous mutation in the gene encoding DNA helicase RecQ protein on chromosome 15q26. This Bloom-associated helicase unwinds a variety of DNA substrates including Holliday junction, and is involved in several pathways contributing to the maintenance of genome stability. Identification of pathogenic Bloom variants is required for heterozygote testing in at-risk families. [provided by RefSeq, May 2020]'
• Locus ID: 641