CD41 (ITGA2B) (NM_000419) Human 3' UTR Clone

CAT#: SC201924

3`UTR clone of integrin alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex antigen CD41) (ITGA2B) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ITGA2B
• Synonyms: BDPLT2; BDPLT16; CD41; CD41B; GP2B; GPIIb; GT; GTA; HPA3; PPP1R93
• ACCN: NM_000419
• Insert Size: 193 bp
• Sequence Data:
  Insert Sequence

  >SC201924 3'UTR clone of NM_000419
  The sequence shown below is from the reference sequence of NM_000419. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  GATGAAGAGGGGGAGTGATGGTGCAGCCTACACTATTCTAGCAGGAGGGTTGGGCGTGCTACCTGCACCG
  CCCCTTCTCCAACAAGTTGCCTCCAAGCTTTGGGTTGGAGCTGTTCCATTGGGTCCTCTTGGTGTCGTTT
  CCCTCCCAACAGAGCTGGGCTACCCCCCCTCCTGCTGCCTAATAAAGAGACTG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000419.3
• Summary: 'This gene encodes a member of the integrin alpha chain family of proteins. The encoded preproprotein is proteolytically processed to generate light and heavy chains that associate through disulfide linkages to form a subunit of the alpha-IIb/beta-3 integrin cell adhesion receptor. This receptor plays a crucial role in the blood coagulation system, by mediating platelet aggregation. Mutations in this gene are associated with platelet-type bleeding disorders, which are characterized by a failure of platelet aggregation, including Glanzmann thrombasthenia. [provided by RefSeq, Jan 2016]'
• Locus ID: 3674