ABCB6 (NM_005689) Human 3' UTR Clone

CAT#: SC202005

3`UTR clone of ATP-binding cassette sub-family B (MDR/TAP) member 6 (ABCB6) nuclear gene encoding mitochondrial protein for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: ABCB6
• Synonyms: ABC; ABC14; DUH3; LAN; MCOPCB7; MTABC3; PRP; umat
• ACCN: NM_005689
• Insert Size: 182
• Sequence Data:
  Insert Sequence

  >SC202005 3'UTR clone of NM_005689
  The sequence shown below is from the reference sequence of NM_005689. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  CCTCTGAAGACACTAAGCCTCAGACCATGGAACGGTGACAAAAGTTTGGCCACTTCCCTCTCAAAGACTA
  ACCCAGAAGGGAATAAGATGTGTCTCCTTTCCCTGGCTTATTTCATCCTGGTCTTGGGGTATGGTGCTAG
  CTATGGTAAGGGAAAGGGACCTTTCCGAAAAACATCTTTTGG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).

Reference Data

• RefSeq: NM_005689.1
• Summary: This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ABC proteins transport various molecules across extra- and intra-cellular membranes. This protein is a member of the heavy metal importer subfamily and plays a role in porphyrin transport. This gene is the molecular basis of the Langereis (Lan) blood group antigen and mutations in this gene underlie familial pseudohyperkalemia and dyschromatosis universalis hereditaria. [provided by RefSeq, Mar 2017]
• Locus ID: 10058