Apolipoprotein CIII (APOC3) (NM_000040) Human 3' UTR Clone

CAT#: SC202007

3`UTR clone of apolipoprotein C-III (APOC3) for miRNA target validation

Specifications

Product Data

• Vector: pMirTarget
• Species: Human
• Transfection Reporter: RFP
• Assay Reporter: Luciferase
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Symbol: APOC3
• Synonyms: APOCIII
• ACCN: NM_000040
• Insert Size: 216 bp
• Sequence Data:
  Insert Sequence

  >SC202007 3'UTR clone of NM_000040
  The sequence shown below is from the reference sequence of NM_000040. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon
  
  
  CAATTGGCAGAGCTCAGAATTCAAGCGATCGC
  
  TCAGACCAACTTCAGCCGTGGCTGCCTGAGACCTCAATACCCCAAGTCCACCTGCCTATCCATCCTGCGA
  GCTCCTTGGGTCCTGCAATCTCCAGGGCTGCCCCTGTAGGTTGCTTAAAAGGGACAGTATTCTCAGTGCT
  CTCCTACCCCACCTCATGCCTGGCCCCCCTCCAGGCATGCTGGCCTCCCAATAAAGCTGGACAAGAAGCT
  GCTATG
  
  ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
• Restriction Sites: SgfI-MluI
• OTI Disclaimer: Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as 10 ug dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials.

Reference Data

• RefSeq: NM_000040.1
• Summary: 'This gene encodes a protein component of triglyceride (TG)-rich lipoproteins (TRLs) including very low density lipoproteins (VLDL), high density lipoproteins (HDL) and chylomicrons. The encoded protein plays a role in role in the metabolism of these TRLs through multiple modes. This protein has been shown to promote the secretion of VLDL1, inhibit lipoprotein lipase enzyme activity, and delay catabolism of TRL remnants. Mutations in this gene are associated with low plasma triglyceride levels and reduced risk of ischemic cardiovascular disease, and hyperalphalipoproteinemia, which is characterized by elevated levels of high density lipoprotein (HDL) and HDL cholesterol in human patients. This gene and other related genes comprise an apolipoprotein gene cluster on chromosome 11. [provided by RefSeq, Sep 2017]'
• Locus ID: 345